View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17581_low_42 (Length: 224)
Name: NF17581_low_42
Description: NF17581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17581_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 206
Target Start/End: Original strand, 47797667 - 47797857
Alignment:
| Q |
16 |
tattttactggaatagtggtaatgactagtatctacaggagaaatgttttttggtcatcaaaatgtggatgccatttatatttgtgtgtatactccctca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47797667 |
tattttactggaatagtggtaatgactagtatctacaggagaaatgttttttggtcatcaaaatgtggatgccatttatatttgtgtgtatactccctca |
47797766 |
T |
|
| Q |
116 |
attcctaattataatcatagaaaaatttgaagtcccttttcaagttaccaaagtgtgtgtgtatgcgtgtgtatcttttccgcagtagaaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47797767 |
attcctaattataatcatagaaaaatttgaattcccttttcaagttaccaaagtgtgtgtgtatgcgtgtgtatcttttccgcagtagaaa |
47797857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University