View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17581_low_45 (Length: 216)
Name: NF17581_low_45
Description: NF17581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17581_low_45 |
 | |
|
| [»] scaffold0048 (3 HSPs) |
| | |
|
| [»] scaffold0185 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0048 (Bit Score: 103; Significance: 2e-51; HSPs: 3)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 5 - 176
Target Start/End: Complemental strand, 85330 - 85159
Alignment:
| Q |
5 |
gggaaactatttggaannnnnnngacatccatatggatcttccttttctctctttgtaactcaaactataggtgccgaaagatgttgccatatggaacaa |
104 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
85330 |
gggaaactatttggaatttttctgacttcaatatggatcttccttttctctctttgcaactcaaactataggtgccgaaagatgttgccatatggtgcaa |
85231 |
T |
|
| Q |
105 |
gatacagtgcagtgtacagtccaaagtatatgaatgtaaatggtcattatagaaagtgaagtagcattatga |
176 |
Q |
| |
|
||||||||| |||| | ||||||||||||||| |||| ||||||||||||||||||||||||| ||| |||| |
|
|
| T |
85230 |
gatacagtgtagtgcatagtccaaagtatatggatgtgaatggtcattatagaaagtgaagtaccataatga |
85159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 28 - 99
Target Start/End: Original strand, 60531 - 60602
Alignment:
| Q |
28 |
gacatccatatggatcttccttttctctctttgtaactcaaactataggtgccgaaagatgttgccatatgg |
99 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
60531 |
gacatcgatatggatcttccttttctctctttggaactcaaactatatctgccaaaagatgttgctatatgg |
60602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0048; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 40 - 99
Target Start/End: Original strand, 47939 - 47998
Alignment:
| Q |
40 |
gatcttccttttctctctttgtaactcaaactataggtgccgaaagatgttgccatatgg |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
47939 |
gatcttccttttctctctttggaactcaaactatagatgccaaaagatgttgctatatgg |
47998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0185 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: scaffold0185
Description:
Target: scaffold0185; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 7161 - 7259
Alignment:
| Q |
1 |
ttttgggaaactatttggaannnnnnngacatccatatggatcttccttttctctctttgtaactcaaactataggtgccgaaagatgttgccatatgg |
99 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
7161 |
ttttgggaaactatttggaatttttttgacatcaatatggatcttccttttctctctttgcaactcaaactatagctgccaaaagatgttgctatatgg |
7259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University