View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17582_high_10 (Length: 226)

Name: NF17582_high_10
Description: NF17582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17582_high_10
NF17582_high_10
[»] chr6 (1 HSPs)
chr6 (113-208)||(32994755-32994850)


Alignment Details
Target: chr6 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 113 - 208
Target Start/End: Complemental strand, 32994850 - 32994755
Alignment:
113 gtgaaacattgctcataatcagattcatgagagtatttaggaaccaagaggtaccttaatttgtcactctttgatctctcaaggataggagctgat 208  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32994850 gtgaaacattgctcataatcagattcatgagagtattgaggaaccaagaggtaccttaatttgtcactctttgatctctcaaggataggagctgat 32994755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University