View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17582_high_11 (Length: 205)
Name: NF17582_high_11
Description: NF17582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17582_high_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 191
Target Start/End: Original strand, 36603879 - 36604053
Alignment:
| Q |
17 |
cagagagccccaccgatccataaaacaccgagacagagaaacgatcaactatcatctctatctttttgtttgggtttgttatgtttagttcaacctcgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36603879 |
cagagagccccaccgatccataaaacaccgagacagagaaacgatcaactatcatctctatctttttgtttgggtttgttatgtttagttcaacctcgaa |
36603978 |
T |
 |
| Q |
117 |
catgccttttagctctgaatcagagacagtgaagttggacacagagattgagctgactcgaaaatgaggtttatg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36603979 |
catgccttttagctctgaatcagagacagtgaagttggacacagagattgagctgactcgaaaatgagttttatg |
36604053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University