View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17582_high_9 (Length: 237)
Name: NF17582_high_9
Description: NF17582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17582_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 9 - 221
Target Start/End: Original strand, 13347635 - 13347847
Alignment:
| Q |
9 |
tccagtactagccatgttcatttgtattccataaaatagaccaacatatttattgtaaacaccatagaacaaggagttcaattttggctcagcaaaaaga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13347635 |
tccagtactagccatgttcatttgtattccataaaatagaccaacatatttattgtaaacaccatagaacaaggagttcaattttggctcagcaaaaaga |
13347734 |
T |
 |
| Q |
109 |
ccagtgagaattcctccaagacttcctgcaattgcatgagtgtgcagcactgccattgtgtcatccactttttgaagtagctttgatcttttgtggatta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13347735 |
ccagtgagaattcctccaagacttcctgcaattgcatgagtgtgtaacactgccattgtgtcatccactttttgaagtagctttgatcttttgtggatta |
13347834 |
T |
 |
| Q |
209 |
ccatcatggtaaa |
221 |
Q |
| |
|
||||||||||||| |
|
|
| T |
13347835 |
ccatcatggtaaa |
13347847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University