View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17583_low_4 (Length: 203)
Name: NF17583_low_4
Description: NF17583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17583_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 5917398 - 5917219
Alignment:
| Q |
16 |
aatctgtaaggattcttaatgacaaaaatgctccaaacctaaccgaagaggctatgcaagctttgcaaatagtgtaagacttcatcttcattgatgcttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5917398 |
aatctgtaaggattcttaatgacaaaaatgcttcaagcctaaccgaagaggctatgcaagctttgcaaatagtgtaagacttcatcttcattgatgcttc |
5917299 |
T |
 |
| Q |
116 |
agttctattgcatcctgaatagtgtactgtcatgataacctgcttagattacctctccaatttttctgcagatgatgatg |
195 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5917298 |
agttccattgcatcctgaatagtgtactgtcatgataacctgcttagattacctctccaatttttctgcagatgatgatg |
5917219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University