View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17584_high_6 (Length: 225)
Name: NF17584_high_6
Description: NF17584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17584_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 28 - 201
Target Start/End: Complemental strand, 15152717 - 15152543
Alignment:
| Q |
28 |
atattgatgggcctgatgggtttagaacttgatgagtggataatgaatttaatgaagnnnnnnnnt-tcaatgagtgctataagcatgaaggagaatatt |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
15152717 |
atattgatgggcctgatgggtttagaacttgatgagtggataatgaatttaatgaagaaaaaaaaaatcaatgagtgctgtaagcatgaaggagaatatt |
15152618 |
T |
 |
| Q |
127 |
ttgtaaaaaatgtgctcccccattgtcatatgttcaaatttttagttacattttggccataccaccatgtgatat |
201 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15152617 |
ttgaaaaaaatgtgctcccccattgtcatatgttcaaatttttagttacattttggccataccaccatgtgatat |
15152543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University