View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17584_low_12 (Length: 249)
Name: NF17584_low_12
Description: NF17584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17584_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 45313044 - 45313264
Alignment:
| Q |
19 |
ctttctcatccttatgtcatcttttctgaaatttgattttcttataaaattgaatcaatgatttgaagggtatcagttctgtttgatgcatggtttaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45313044 |
ctttctcatccttatgtcatcttttctgaaatctgattttcttataaaattgaatcaatgatttgaagggtatcagttctgtttgatgcatggtttaaat |
45313143 |
T |
 |
| Q |
119 |
cattatttgctttcaaatgaaagaggaacggatatcataagtcaaaacaaggaggggatttttagcatatttggtaagaattgcgaccttgcgttgttca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45313144 |
cattatttgctttcaaatgaaagaggaacggatatcataagtcaaaacaaggaggggatttttagcatatttggtaagaattgcgaccttgcgttgttca |
45313243 |
T |
 |
| Q |
219 |
atcatcataatacaatttcat |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45313244 |
atcatcataatacaatttcat |
45313264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 27758732 - 27758950
Alignment:
| Q |
19 |
ctttctcatccttatgtcatcttttctgaaatttgattttcttataaaattgaatcaatgatttgaagggtatcagttctgtttgatgcatggtttaaat |
118 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27758732 |
ctttctcatcctt--gtcatcttttctgaaatctgattttcttataaaattgaatctatgatttgaagggtaccagttctgtttgatgcatggtttaaat |
27758829 |
T |
 |
| Q |
119 |
cattatttgctttcaaatgaaagaggaacggatatcataagtcaaaacaaggaggggatttttagcatatttggtaagaattgcgaccttgcgttgttca |
218 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27758830 |
cattatttgctttcaaacgaaagaggaacagatatcataagtcaaaacaaggaggggatttttagcatatttggtaagaattgcgaccttgcgttgttca |
27758929 |
T |
 |
| Q |
219 |
atcatcataatacaatttcat |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27758930 |
atcatcataatacaatttcat |
27758950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University