View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17584_low_4 (Length: 366)
Name: NF17584_low_4
Description: NF17584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17584_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 330
Target Start/End: Original strand, 50390114 - 50390427
Alignment:
| Q |
18 |
cttttgttccctctttacaaaaatcttgtgtttgctctaaatttatggcatcttcttgtctttatatgtctgttacaagaagatttgcatggaaaataaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50390114 |
cttttgttccctctttacaaaaatcttgtgtttgctctaaatttatggcatcttcttgtctttatatgtctgttacaagaagatttgcatggaaaataaa |
50390213 |
T |
|
| Q |
118 |
actgatgacctaga-gatttgcatgtttgattttttagtatgcaatgtttattattcaactttaaggtgcataagtcatgttgtgacaactttttgttac |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50390214 |
actgatgacctagaagatttgcatgtttgattttttagtatgcaatgtttattattcaactttaaggtgcataagtcatgttgtgacaactttttgttac |
50390313 |
T |
|
| Q |
217 |
ctgctgtcgcaaccaagatcgctctgcaaccctcgtgccaaattatttgaatttctagattttgaattctataagtgttactatgcatttgtgctgacat |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50390314 |
ctgctgtcgcaaccaagatcgctctgcaaccctcgtgccaaattatttgaatttctagattttgaattctataagtgttactatgcatttgtgctaacat |
50390413 |
T |
|
| Q |
317 |
acgatgatgtccat |
330 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
50390414 |
acgatgatgtccat |
50390427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University