View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17584_low_9 (Length: 263)
Name: NF17584_low_9
Description: NF17584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17584_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 8 - 242
Target Start/End: Original strand, 8621968 - 8622203
Alignment:
| Q |
8 |
taatattcttctt-taaatatgatggagagtgtcctaattaaaagttgaaagggatgtcatagtgcaaatcatccaccataacattagatgagtaaagta |
106 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8621968 |
taatattcttcttataaatatgatgcagagtgtcctaattaaaagttgaaagggatgtcatagtgcaaatcatccaccataacattagatgagtaaagta |
8622067 |
T |
|
| Q |
107 |
caatagacctttgttttttaagttatctcgttctagattaaaatttgattgcgtgcatagaaatgtcaaagtaataccataaaaagaaatcgaacaaaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8622068 |
caatagacctttgttttttaagttatctcgttctagattaaaatttgattgcgtgcatagaaatgtcaaagtaataccataaaaagaaatcgaacaaaat |
8622167 |
T |
|
| Q |
207 |
aatgcatttgatatagatttggtctctaacctttag |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8622168 |
aatgcatttgatatagatttggtctctaacctttag |
8622203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University