View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17585_low_3 (Length: 319)
Name: NF17585_low_3
Description: NF17585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17585_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 7369641 - 7369479
Alignment:
| Q |
15 |
cttttgtctcgcacttattgggtatgtctaattatataaaaccatgcaaactttaatcaaattataatgaatcaactaaattaattgtcagctcattgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7369641 |
cttttgtctcgcacttattgggtatgtctaattatataaaaccatgcaaactttaatcaaattataatgaatcaactaaattaattgtcagctcattgat |
7369542 |
T |
|
| Q |
115 |
nnnnnnnnncttaattttataaattaaaggaataaagtttaaattcacttttgaaagttgtaag |
178 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7369541 |
-aaaaaaaacataattttataaattaaaggaataaagtttaaattcacttttgaaagttgtaag |
7369479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 240 - 313
Target Start/End: Complemental strand, 7369417 - 7369344
Alignment:
| Q |
240 |
gttgaatttaacaggattacagcaaatcaaggtttctacttgcttgggttggataacacatcccctacctttgc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7369417 |
gttgaatttaacaggattacagcaaatcaaggtttctacttgcttgggttggataacacatcccctacctttgc |
7369344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 250 - 313
Target Start/End: Complemental strand, 52730553 - 52730490
Alignment:
| Q |
250 |
acaggattacagcaaatcaaggtttctacttgcttgggttggataacacatcccctacctttgc |
313 |
Q |
| |
|
||||||||||||| || || |||||||| |||||||| ||||| |||||||| || |||||||| |
|
|
| T |
52730553 |
acaggattacagccaaccagggtttctatttgcttggcttggacaacacatctccaacctttgc |
52730490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University