View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17586_low_4 (Length: 241)
Name: NF17586_low_4
Description: NF17586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17586_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 78 - 137
Target Start/End: Original strand, 7257902 - 7257961
Alignment:
| Q |
78 |
tcacagttataatagaatttcaatcttagtacaacatgaaccacaattaatagatgacag |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7257902 |
tcacagttataatagaatttcaatcttagtacaacatgaaccacaattaatagatgacag |
7257961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 10 - 72
Target Start/End: Original strand, 7257800 - 7257862
Alignment:
| Q |
10 |
catcatcataaacaggtgaatctcggaatgaattgaagggcctctcagaagagaaattattaa |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7257800 |
catcatcataaacaggtgaatctcggaatgaactgaagggcctctcagaagagaaattattaa |
7257862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 187 - 241
Target Start/End: Original strand, 7258005 - 7258059
Alignment:
| Q |
187 |
aatgaaatcaacttactactccaagttgttctgatgctttggccttccaaagtct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7258005 |
aatgaaatcaacttactactccaagttgttctgatgctttggccttccaaagtct |
7258059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University