View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17587_low_2 (Length: 251)
Name: NF17587_low_2
Description: NF17587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17587_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 30370476 - 30370715
Alignment:
| Q |
1 |
cagagtgtgtgaagaatttggagacaagaaatacgatgatgaagaatctcaatatcttctccaagaaacctaagccaaaaggttccttctttatcattcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
30370476 |
cagagtgtgtgaagaatttggagacaagaaatacgatgatgaagaatctcaatatcttctccaagaaacctaagccaaaaggttcattctttatcatt-c |
30370574 |
T |
|
| Q |
101 |
attcgatcactcactttctcatgttttgtctttcttcttctgttctgttccttccactgtcattcaatttt-----attaaaacaaccatttttctatta |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30370575 |
attcgatcactcactttctcatgttttgtctttcttcttctgttctgttccttccaccgtcattcaattttgcttgattaaaacaaccatttttctatta |
30370674 |
T |
|
| Q |
196 |
acannnnnnntctctatccatgcagaggttctgagagagag |
236 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30370675 |
acaccccccctctctatccatgcagaggttctgagagagag |
30370715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University