View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_high_26 (Length: 319)
Name: NF17588_high_26
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_high_26 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 33104169 - 33104450
Alignment:
| Q |
1 |
aaaagaaaggaagtaactaaagaccgtccattattttggagtttgttactacaatgtaacataaccaagtgaccatgtttgctgaacaataacgtgggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33104169 |
aaaagaaaggaagtaactaaagaccgtccattattttggagtttgttactacaatgtaacataaccaagtgaccatgtttgctgaacaataacgtgggga |
33104268 |
T |
 |
| Q |
101 |
ttgcatagtgatagtgcaatgtccccgacatgtggggtctgatattttagcggtccacgactatggtagggacatgtactgttttgcaaccaaaatttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33104269 |
ttgcatagtgatagtgcaatgtccccgacatgtggggtctgatattttagcggtccacgactatggtagggacatgtactattttgcaaccaaaatttgg |
33104368 |
T |
 |
| Q |
201 |
caaatgtctaatttcactaatcaggaaaaacttcaaaacggaaaagcattttcacatgatgataacgtgaatgtaaattgtg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33104369 |
caaatgtctaatttcactaatcaggaaaaacttcaaaacggaaaagcattttcacatgatgataacgtgaatgtaaattgtg |
33104450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 277 - 319
Target Start/End: Complemental strand, 10470888 - 10470846
Alignment:
| Q |
277 |
attgtgatgttaattcagtctctaatgtagataacgtgaagtc |
319 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
10470888 |
attgtgatgttgattcagcctctaatgtagataacgtgaagtc |
10470846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University