View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_high_35 (Length: 263)
Name: NF17588_high_35
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_high_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 211 - 255
Target Start/End: Original strand, 38397320 - 38397364
Alignment:
| Q |
211 |
agctatcaacacatcaatccaaaaatttctggttttgcttcattt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38397320 |
agctatcaacacatcaatccaaaaatttctggttttgcttcattt |
38397364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 95 - 136
Target Start/End: Original strand, 38397204 - 38397245
Alignment:
| Q |
95 |
caagaaacaacactgttgtattgtatattctatcttgaagtg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38397204 |
caagaaacaacactgttgtattgtatattctatcttgaagtg |
38397245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University