View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_high_44 (Length: 246)
Name: NF17588_high_44
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 3294500 - 3294284
Alignment:
| Q |
18 |
aagtatggcatcgaaaaaacaaaggactattttttgatacatacacctatgcctacatagccaaactagtgtttgcttaatgagaaaaaagtatcataga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294500 |
aagtatggcatcgaaaaaacaaaggactattttttgatacatacacctatgcctatatactcaaactagtgtttgcttaatgagaaaaaagtatcataga |
3294401 |
T |
 |
| Q |
118 |
tacccacattttcatgtttcatgttgtaatattattactgcatagcactggtatctcatatggatttgtttccgatatgctatctttttagatgctttct |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294400 |
tatccacattttcatgtttcatgttgtaatattattactgcatagcactggtatctcatatggatttgtttccgatatgctatctttttagatgctttct |
3294301 |
T |
 |
| Q |
218 |
cagcgtgtgtttccctt |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3294300 |
cagcgtgtgtttccctt |
3294284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University