View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17588_high_45 (Length: 243)

Name: NF17588_high_45
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17588_high_45
NF17588_high_45
[»] chr4 (1 HSPs)
chr4 (5-226)||(32967154-32967375)


Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 5 - 226
Target Start/End: Original strand, 32967154 - 32967375
Alignment:
5 tatatggaagccacagcttttctgggtttcagcaggagctcctcttgcatgtgtcatcatttcaaccatcatcacttttgtaatcaagggtcaacttcat 104  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32967154 tatatggaagccacagcttttctgggtttcagctggagctcctcttgcatgtgtcatcatttcaaccatcatcacttttgtaatcaagggtcaacttcat 32967253  T
105 gatatcagtattgtaagtatctatagtgcttatgttatcatctatattattatgatttagtttcttaactaaaaaacaaatgtcatgttacttactagat 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
32967254 gatatcagtattgtaagtatctatagtgcttatgttatcatctatattattatgatttagtttcttaactaaaaaaaaaatgtcatgttacttactagat 32967353  T
205 tggtaaattgcaacaaggaata 226  Q
    ||||||||||||||||||||||    
32967354 tggtaaattgcaacaaggaata 32967375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University