View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_high_49 (Length: 237)
Name: NF17588_high_49
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_high_49 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 63 - 237
Target Start/End: Complemental strand, 48320650 - 48320476
Alignment:
| Q |
63 |
tgaatccaagtattgaagatgaagatctcatgtttgactgcttcgaaaattcccttgacccaagtttcttcaatatgagtaacccaacactagcatattt |
162 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48320650 |
tgaatccaagtatggaagatgaagatctcatgtttgactgtttcgaaaattcccttgacccaagtttcttcaatatgagtaacccaacactagcagattt |
48320551 |
T |
 |
| Q |
163 |
atccattgataacaataacaacaatgtgggtcccacttcattgtcccaacaaactcagcatatcaatttatccat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48320550 |
atccattgataacaataacaacaatgtgggtcccacttcattgtcccaacaaactcagcatatcaatttatccat |
48320476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 10 - 51
Target Start/End: Complemental strand, 48320720 - 48320679
Alignment:
| Q |
10 |
catcatcaccatcccataattttgtttcaaccaacgtaaatt |
51 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48320720 |
catcatcaccattccataattttgtttcaaccaacgtaaatt |
48320679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University