View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_high_51 (Length: 230)
Name: NF17588_high_51
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_high_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 37 - 202
Target Start/End: Complemental strand, 1880964 - 1880803
Alignment:
| Q |
37 |
taatatttacacactcatggaacattttctnnnnnnnnttagaaggaatttcaaaataaaacaaaattagattgggagcaaatttgaggtgtctaaaaac |
136 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1880964 |
taatatttacacattcatggaacattttctaaaaaaaattagaaggaatttcaaaataaaacaaaattagattgggagcaaatttgaggtgtctaaaaac |
1880865 |
T |
 |
| Q |
137 |
aactatatatcttgacaaaataactttggacacaaaaccttatttatttaagacttaaaatctttt |
202 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1880864 |
aac----tatcttgacaaaataactttggacacaaaaccttatttatgtaagacttaaaatctttt |
1880803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University