View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_high_53 (Length: 229)
Name: NF17588_high_53
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_high_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 44694876 - 44694671
Alignment:
| Q |
17 |
atattccaccaatcatcgatcaggtcacaaattagacacaatatcaaacatgcaatcttagagcaatgcatttccaataaatcctacaatatcaaacact |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694876 |
atattccaccaattatcgatcaggtcacaaattagacacaatatcaaacatgcaatcttagagcaatgcatttccaataaatcctacaatatcaaacact |
44694777 |
T |
 |
| Q |
117 |
g----------agacactagacacgacattaaagctgacacggtaaccacatgtgtcagacattgtgtaccggacacgcctttagtctggcatataattg |
206 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44694776 |
gacgcaaacacagacactagacacgacattaaagctgacacggtaaccacatgtgtcagacattgtgtaccggacacgcctttagtatggcatataattg |
44694677 |
T |
 |
| Q |
207 |
ccttat |
212 |
Q |
| |
|
|||||| |
|
|
| T |
44694676 |
ccttat |
44694671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University