View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17588_high_59 (Length: 211)

Name: NF17588_high_59
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17588_high_59
NF17588_high_59
[»] chr1 (1 HSPs)
chr1 (12-193)||(2487532-2487713)


Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 2487532 - 2487713
Alignment:
12 agcataggttgtcttagaagccgcgaaaaacctcgagctactgtttcaatggatgagggatgtaagggagaaataattcaaggccaaaccgtgactaaag 111  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2487532 agcataggttgtcttagaagccgcgaaaaacctcaagctactgtttcaatggatgagggatgtaagggagaaataattcaaggccaaaccgtgactaaag 2487631  T
112 atgatggatcatcaggcttctggagcagcagcacttttgaaaaggatcatagtgaagctcggtcgcggagaagtgtttcttc 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2487632 atgatggatcatcaggcttctggagcagcagcacttttgaaaaggatcatagtgaagctcggtcgcggagaagtgtttcttc 2487713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University