View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_high_61 (Length: 208)
Name: NF17588_high_61
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_high_61 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 35353260 - 35353069
Alignment:
| Q |
17 |
ataagtggcattatttacttttcacattttcaacaccgttgaaaattttgaacttccaaagatggatgagtatcagaaatcactcactagagtttatatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35353260 |
ataagtggcattatttacttttcacattttcaacaccgttgaaaattttgaacttccaaagatggatgagtatcagaaatcactcactagagtttatatt |
35353161 |
T |
|
| Q |
117 |
tctcaatttgaatagtcaaaataataaccccactcactagaatttatgtttctcaatttgaatagtccaaataataaccccaaaagcatagc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35353160 |
tctcaatttgaatagtcaaaataataaccccactcactagaatttatgtttctcaatttgaatagtcaaaataataaccccaaaagcatagc |
35353069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University