View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_low_28 (Length: 294)
Name: NF17588_low_28
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 62 - 275
Target Start/End: Complemental strand, 1881193 - 1880980
Alignment:
| Q |
62 |
gttgaaataccaggtcctagtaatctgaactacgaccataaatgacttaatttatttattctcacgtgacaaaattataagactagtatgtactgtacaa |
161 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1881193 |
gttgaaataccaggccctagtaatctgaactactaccataaatgacttaatttatttattctcacgtgataaaattataagactagtatgtactgtacaa |
1881094 |
T |
 |
| Q |
162 |
ctttttaatcgccgtatttcgacgaaatttactgcaagaataatagaatgaattgagtgacttaggaaatatgagtaaaaagatcaaaattagtaagaac |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1881093 |
ctttttaatcgccgtatttcgacgaaatttactgcaagaataatagtatgaattgagtgacttaggaaatatgggtaaaaagatcaaaattagtaagaac |
1880994 |
T |
 |
| Q |
262 |
tcgaaaaacattat |
275 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1880993 |
tcgaaaaacattat |
1880980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University