View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_low_32 (Length: 288)
Name: NF17588_low_32
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 20 - 267
Target Start/End: Original strand, 48276844 - 48277102
Alignment:
| Q |
20 |
atgagtccgaggaatcggagtcgtcttccacgttcggaagtagaacaagaacagaagattgttcttatgtttatgctaattctcaaactcaaaggaacca |
119 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48276844 |
atgagtcagaggaatcggagtc---ttccacgttgggaagtagaacaagaacagaagattgttcttatgtttatgctaattctcaaactcaaaggaacca |
48276940 |
T |
 |
| Q |
120 |
actccttacactattcttatgatcgatctcatgccnnnnnnngtttatttattcttaattttgaaatta---------------atatattcaaaattgc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
48276941 |
actccttacactattcttatgatcgatctcatgccttttttc-tttatttattcttaattttgaaattaatatcccataactttatatattgaaaattgc |
48277039 |
T |
 |
| Q |
205 |
tctgttcagagtattatggtaaataattgtcaccaccaagtatttttctataatccatcctct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48277040 |
tctgttcagagtattatggtaaataattgtcaccaccaagtatttttctataatccatcctct |
48277102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University