View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_low_56 (Length: 226)
Name: NF17588_low_56
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 187
Target Start/End: Complemental strand, 336099 - 335932
Alignment:
| Q |
20 |
aaggggaatcgaactcaaatcctagaatagttttgtcttcattggtctttttatgtgaaaataaaaaatgcaagttggaattggaaataaatggttatag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
336099 |
aaggggaatcgaactcaaatcctagaatagttttgtcttcattggtctttttatgtgaaaatcaaaattgcaagttggaattggaaataaatggttatag |
336000 |
T |
 |
| Q |
120 |
gcatagaaggtaaagagagagaaatccacaaaacaaaacacaagaaggcattgacatcacatgctata |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
335999 |
gcatagaaggtaaagagagagaaatccacaaaacaacacacaagaaggcattgacatcacatgctata |
335932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University