View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_low_59 (Length: 214)
Name: NF17588_low_59
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_low_59 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 11 - 199
Target Start/End: Complemental strand, 5461873 - 5461684
Alignment:
| Q |
11 |
attatactagaaacctttatattgtagaaaaa-tatggatgatacggtcgaaaatgcaatcgacttcaaaatcatttatattttagaactttgatgttaa |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5461873 |
attatgctagaaacctttatattgtagaaaaaatatggatggtacggtcgaaaatgcaatcgacttcaaaatcatttatattttagaactttgatgttaa |
5461774 |
T |
|
| Q |
110 |
tgcaggatctgaagaaatcacatgagtaccttgtgacatcatatggtgccgatccaacaggaaattcagatagcactgatgcacttcttg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5461773 |
tgcaggatctgaagaaatcacatgagtaccttgtgacattatatggtgccgatccaacaggaaattcagatagcactgatgcacttcttg |
5461684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 15159399 - 15159451
Alignment:
| Q |
136 |
taccttgtgacatcatatggtgccgatccaacaggaaattcagatagcactga |
188 |
Q |
| |
|
|||| ||||||||| |||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
15159399 |
taccatgtgacatcctatggtgcagacccaacaggcaattcagatagcactga |
15159451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University