View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_low_61 (Length: 211)
Name: NF17588_low_61
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_low_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 12 - 193
Target Start/End: Original strand, 2487532 - 2487713
Alignment:
| Q |
12 |
agcataggttgtcttagaagccgcgaaaaacctcgagctactgtttcaatggatgagggatgtaagggagaaataattcaaggccaaaccgtgactaaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2487532 |
agcataggttgtcttagaagccgcgaaaaacctcaagctactgtttcaatggatgagggatgtaagggagaaataattcaaggccaaaccgtgactaaag |
2487631 |
T |
 |
| Q |
112 |
atgatggatcatcaggcttctggagcagcagcacttttgaaaaggatcatagtgaagctcggtcgcggagaagtgtttcttc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2487632 |
atgatggatcatcaggcttctggagcagcagcacttttgaaaaggatcatagtgaagctcggtcgcggagaagtgtttcttc |
2487713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University