View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17588_low_62 (Length: 210)
Name: NF17588_low_62
Description: NF17588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17588_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 42895899 - 42895723
Alignment:
| Q |
18 |
ccttttacgcttccctaccgaatatgatcgttccacaatctcaactcatcagatatgattctgtcagttccacttacccttttgatcttacttttcaaat |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42895899 |
ccttttacgcttcccaaccgaatatgatcgttccacaatctcaactcatcagatatgattctgtcagttccacttacccttttgatcttacttttcaaat |
42895800 |
T |
|
| Q |
118 |
ttctcatcaaaatcccattttttatgttttgtcatttggcttgtttttataattcttagtatcattctttatgttcat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42895799 |
ttctcatcaaaatcccattttttatgttttgtcatttgggttgtttttataattcttagtatcatt-tttatgttcat |
42895723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University