View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17589_high_17 (Length: 250)

Name: NF17589_high_17
Description: NF17589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17589_high_17
NF17589_high_17
[»] chr3 (1 HSPs)
chr3 (18-186)||(45223698-45223866)


Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 45223866 - 45223698
Alignment:
18 tagagaaagcgggggtttcgaggaggaggccgctacggaagagaacatcgcagtcagtgacgtggcggtggagagtggcgatgagtgaatcgatttggct 117  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45223866 tagagaaagcgggggtttcgaggaggaggccgctacggaaaagaacatcgcagtcagtgacgtggcggtggagagtggcgatgagtgaatcgatttggct 45223767  T
118 ttgagtttggagtttaccgtggggtaaaatttgggattgacagtggtgagagagtgaaacggcgtcgtt 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45223766 ttgagtttggagtttaccgtggggtaaaatttgggattgacagtggtgagagagtgaaacggcgtcgtt 45223698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University