View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17589_high_21 (Length: 247)
Name: NF17589_high_21
Description: NF17589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17589_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 4 - 231
Target Start/End: Original strand, 51849601 - 51849828
Alignment:
| Q |
4 |
aatacgtttagggactattttaaccactcgttgcatgttcagggatcaaaataattataaccccttttaaaaaggaataacatgtattgtgggatcagtc |
103 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51849601 |
aatacattcagggactattttaaccactcgttgcatgttcagggatcaaaataattataaccccttttaaaaaggaataacatgtattgtgggatcagtc |
51849700 |
T |
 |
| Q |
104 |
acagataaaatatgtgctgcaatgtgggatcaacatatagatattttgtctgttttctcctcttaacattgtatctaagcacctcggaatactgccaacc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51849701 |
acagataaaatatgtgctgcaatgtgggatcaacatatagatattttgtctgttttctcctcttaacattgtatctaagcacctcggaatactgccaacc |
51849800 |
T |
 |
| Q |
204 |
tgtctttctcttcaacctatctttatgt |
231 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
51849801 |
tgtctttctcttcaacctatcttcatgt |
51849828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University