View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17589_high_24 (Length: 238)
Name: NF17589_high_24
Description: NF17589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17589_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 23746798 - 23746609
Alignment:
| Q |
17 |
aattagcttacataataaataggacacaagtagagatggagagcattttttaaagtgacactaacagtcattttacttccgccttcatggaaatttgaac |
116 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23746798 |
aattagcttacataatgaataggacacaagtagagatggagagcattttttaaagcgacactaacagtcattttacttctgccttcatggaaatttgaac |
23746699 |
T |
 |
| Q |
117 |
caagtccctcgagtttacgagacccttggacagaagggaaacccttggac-aaactcttcttttctctcctattctcattctttcaataa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23746698 |
taagtccctcgagtttacgagacccttggacagaagggaaacccttagacaaaactcttcctttctctcctattctcattctttcaataa |
23746609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University