View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17589_high_28 (Length: 220)
Name: NF17589_high_28
Description: NF17589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17589_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 29 - 186
Target Start/End: Original strand, 50716642 - 50716803
Alignment:
| Q |
29 |
aattgtacatttaggatttaattatgcagcttattgcttctttgttttatcgact--------gaagaattacactcgttcactcaatatgtgtttataa |
120 |
Q |
| |
|
||||| |||||| |||||||| ||||||||||||||||||||||||||| ||||| |||| |||||||| ||||| |||||||||||||| |
|
|
| T |
50716642 |
aattgcacattttggatttaactatgcagcttattgcttctttgttttaccgactacataaaagaaggattacactagttcatacaatatgtgtttat-- |
50716739 |
T |
 |
| Q |
121 |
tttactcccaaaccctaaaatttggatggataactatcaacatatggaagtgtggaatttaccccc |
186 |
Q |
| |
|
|| | ||||| |||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50716740 |
ttaccccccaacccctaaaattgggatggataactatcaac--atggaagtgtggaatttaccccc |
50716803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 141 - 204
Target Start/End: Original strand, 50715121 - 50715182
Alignment:
| Q |
141 |
tttggatggataactatcaacatatggaagtgtggaatttaccccctcctgtagtgcatgattt |
204 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
50715121 |
tttggatggataactatcaacat--ggaagtgtggaatttaccccctcctatagtgcatgattt |
50715182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 50715071 - 50715121
Alignment:
| Q |
1 |
acaaaaattaggtcatttatgaaaaaagaattgtacatttaggatttaatt |
51 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50715071 |
acaaaaattagttcatttatgaaaaaagaattgtacatttaggatttaatt |
50715121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University