View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17589_high_30 (Length: 205)
Name: NF17589_high_30
Description: NF17589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17589_high_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 11 - 187
Target Start/End: Original strand, 8926500 - 8926676
Alignment:
| Q |
11 |
aagcaaaggtttggagtgtgttcagtcagaaataaatgatttggattgggaaagcactttctttttgcgccatcttccttcttctaatatttcagagatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8926500 |
aagcaaaggtttggagtgtgttcagtcagaaataaatgatttggattgggaaagcactttctttttgcgccatcttccttcttctaatatttcagagatc |
8926599 |
T |
|
| Q |
111 |
ccagatcttgatgaagattacaggtcacatattttaatgttttgttaaaatatatatttagtatttaattcatatac |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8926600 |
ccagatcttgatgaagattacaggtcacatattttaatgttttgttaaaatatatatttagtatttaattcatatac |
8926676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 11 - 137
Target Start/End: Original strand, 55523247 - 55523373
Alignment:
| Q |
11 |
aagcaaaggtttggagtgtgttcagtcagaaataaatgatttggattgggaaagcactttctttttgcgccatcttccttcttctaatatttcagagatc |
110 |
Q |
| |
|
|||||||||||| |||| || |||||| ||||| ||||| |||||||||||||||||||||||||||||||| |||||| | ||| || ||||||||| |
|
|
| T |
55523247 |
aagcaaaggtttagagtttgctcagtctgaaattaatgacttggattgggaaagcactttctttttgcgccaccttcctaactttaacatatcagagatc |
55523346 |
T |
|
| Q |
111 |
ccagatcttgatgaagattacaggtca |
137 |
Q |
| |
|
|| ||||||||| | || ||||||||| |
|
|
| T |
55523347 |
cctgatcttgatcatgactacaggtca |
55523373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University