View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17589_high_6 (Length: 382)
Name: NF17589_high_6
Description: NF17589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17589_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 13 - 341
Target Start/End: Original strand, 4857773 - 4858102
Alignment:
| Q |
13 |
gaagaatatactcctcaaaatagggaatggagacgtggatggagaaaattctggacggcggggatggggagtacc-tactccggcgccgtttacatacct |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4857773 |
gaagaaaatactcctcaaaatagggaatggagacgtggatggagaaaattttggactgcggggatggggagtaccctactccggcgccgtttacatacct |
4857872 |
T |
 |
| Q |
112 |
agtttatctaagtttatttatgctgatgtttgcttgttttcttctggttgacagatatcaggtctacttgtgtgatgttggattcatggaatttgaattc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
4857873 |
agtttatctaagtttatttatgctgatgtttgcttgttttcttctggttgacagatatcaggtctacttgtgtgatgttggattcatagaattttaattc |
4857972 |
T |
 |
| Q |
212 |
aaattcacctctgttttgatcaggggtgttcatagaggtgtgacctttaattggcaaagaaatgtgcccaactttgaaaggaagatagtgtagtggggtc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4857973 |
aaattcacctctgttttgatcaggggtgttcatagaggtgtgacctttaattggcaaagaaatgtgcccaactttgaaaggacgatagtgtagtggggtc |
4858072 |
T |
 |
| Q |
312 |
taatttggctgcaatttgctgatgttatga |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4858073 |
taatttggctgcaatttgctgatgttatga |
4858102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University