View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17589_low_29 (Length: 232)
Name: NF17589_low_29
Description: NF17589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17589_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 214
Target Start/End: Original strand, 8926477 - 8926676
Alignment:
| Q |
15 |
caaaggttcaaagaaatggtagcaagcaaaggtttggagtgtgttcagtcagaaataaatgatttggattgggaaagcactttctttttgcgccatcttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8926477 |
caaaggttcaaagaaatggtagcaagcaaaggtttggagtgtgttcagtcagaaataaatgatttggattgggaaagcactttctttttgcgccatcttc |
8926576 |
T |
|
| Q |
115 |
cttcttctaatatttcagagatcccagatcttgatgaagattacaggtcacatattttaatgttttgttaaaatatatatttagtatttaattcatatac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8926577 |
cttcttctaatatttcagagatcccagatcttgatgaagattacaggtcacatattttaatgttttgttaaaatatatatttagtatttaattcatatac |
8926676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 13 - 164
Target Start/End: Original strand, 55523222 - 55523373
Alignment:
| Q |
13 |
agcaaaggttcaaagaaatggtagcaagcaaaggtttggagtgtgttcagtcagaaataaatgatttggattgggaaagcactttctttttgcgccatct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| || |||||| ||||| ||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
55523222 |
agcaaaggttcaaagaaatggtagcaagcaaaggtttagagtttgctcagtctgaaattaatgacttggattgggaaagcactttctttttgcgccacct |
55523321 |
T |
|
| Q |
113 |
tccttcttctaatatttcagagatcccagatcttgatgaagattacaggtca |
164 |
Q |
| |
|
|||| | ||| || ||||||||||| ||||||||| | || ||||||||| |
|
|
| T |
55523322 |
tcctaactttaacatatcagagatccctgatcttgatcatgactacaggtca |
55523373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University