View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17589_low_30 (Length: 228)
Name: NF17589_low_30
Description: NF17589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17589_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 197
Target Start/End: Original strand, 22319190 - 22319372
Alignment:
| Q |
15 |
gatgaatgtatggaagttagagaaatgattgtcatcttactttgttgagtttaaatatctctcatgcttaataaccaagtgatttttattgttcttattc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22319190 |
gatgaatgtatggaagttagagaaatgattgtcatcttactttgttgagtttaaatatctctcatgcttaatatccaagtgatttttattgttcttattc |
22319289 |
T |
 |
| Q |
115 |
tttatcctctttaactttacagtctaatcccccttattagggttatctcatatttaccttggcttcgttacaacctcaataaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22319290 |
tttatcctctttaactttacagtctaatcccccttattagggttatctcatatttaccttggcctcgttacaacctcaataaa |
22319372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University