View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17589_low_33 (Length: 208)
Name: NF17589_low_33
Description: NF17589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17589_low_33 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 14103733 - 14103904
Alignment:
| Q |
19 |
tgatatcttgagcatccaaccattgatttaactccatgaactagacgtcatgggcatcaaatctctaattcatgaacaactgcaagtttctcattccatc |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14103733 |
tgatatcttgagcatcaaaccattgatttaactccatgaactagacgtcatgggcatcaaatctctgattcatgaacaactgcaagtttctcattccatc |
14103832 |
T |
 |
| Q |
119 |
catcattcatgctaacctcaggtgtcggaggctcgtaatcggggtcattctcttcctcttcatagttagcat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14103833 |
catcattcatgctaacctcaggtgtcggaggctcgtaatcggggtcattctcttcctcttcatagttagcat |
14103904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 27 - 82
Target Start/End: Complemental strand, 224122 - 224067
Alignment:
| Q |
27 |
tgagcatccaaccattgatttaactccatgaactagacgtcatgggcatcaaatct |
82 |
Q |
| |
|
|||||||| |||| |||||||| ||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
224122 |
tgagcatcaaacctttgatttatctccatgaactggacatcaagggcatcaaatct |
224067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University