View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1758_high_40 (Length: 264)
Name: NF1758_high_40
Description: NF1758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1758_high_40 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 42 - 264
Target Start/End: Complemental strand, 47269645 - 47269423
Alignment:
| Q |
42 |
gtcgatctcatcgatctttgtcgatgccaaaccaagagggaaaacgcaacccaaatctgggtgaatcagatgcaaaagaacacaatatggtggcactgta |
141 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47269645 |
gtcgatctcatcgatctttgtcgacgccataccaagagggaaaacgcaacccaaatctgggtgaatcagatgcaaaagaacacaatatggtggcactgta |
47269546 |
T |
 |
| Q |
142 |
gagatcggtgttcacactccatgcgaaagaaatcaaatggagtatgccaaaataaaatagannnnnnnngtattagaactatttgcatgtgtttgattga |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47269545 |
gagatcggtgttcacactccatgcgaaagaaatcaaatggagtatgccaaaataaaatagattttttttgtattagaactatttgcatgtgtttgattga |
47269446 |
T |
 |
| Q |
242 |
taacgagattcatcttattcaat |
264 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
47269445 |
taacgagattcaccttattcaat |
47269423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University