View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1758_high_41 (Length: 262)
Name: NF1758_high_41
Description: NF1758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1758_high_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 1430925 - 1430680
Alignment:
| Q |
1 |
aggttgcttgaatacgcgaaactcggttttaaacta---tttttattcttctannnnnnnacagggttttccagagattttgcggggagtgtctatgaat |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430925 |
aggttgcttgaatacgcgaaactcggttttaaactcacttttttattcttctacttttttacagggttttccagagattttgcggggagtgtctatgaat |
1430826 |
T |
 |
| Q |
98 |
ccatatgtaaataaatatatcccgccatttgaggaattcgagattgaccgttgtattctcccaaaaggggaaacagtagtgttcccggcagttccaggtc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1430825 |
ccatatgtaaataaatatatcccgccatttgaggaattcgagattgaccgttgtattctcccaaaagggcaaacagtagtgttcccggcagttccaggtc |
1430726 |
T |
 |
| Q |
198 |
cgtccatctttttggtcacggccggggaaggatcgatgaacacagg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1430725 |
cgtccatctttttggtcacggccggggaaggatcgatgaacacagg |
1430680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University