View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1758_high_44 (Length: 256)
Name: NF1758_high_44
Description: NF1758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1758_high_44 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 27732978 - 27732836
Alignment:
| Q |
20 |
tttgaatctgatggattggctgctaagcttgctagtgctgacagctctttacttattggatcatatctggatgtacctattggacaagaaattaaaaatg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27732978 |
tttgaatctgatggattggctgctaagctggcaagtgccgacagctctttacttattggatcatatctggatgtacctattggacaagaaattaaaaatg |
27732879 |
T |
|
| Q |
120 |
caggtaagcttttgtacatgatattattaaattattaaaatac |
162 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
27732878 |
caggtaagcttttgtccgtgatattattaaattattaaaatac |
27732836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 161 - 202
Target Start/End: Complemental strand, 27732800 - 27732759
Alignment:
| Q |
161 |
acctttcgaggctcaaattactgtctgatttgttggtttgtc |
202 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||| |||||| |
|
|
| T |
27732800 |
acctttgggggctcaaattactgtctgatttgttgctttgtc |
27732759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University