View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1758_low_41 (Length: 270)
Name: NF1758_low_41
Description: NF1758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1758_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 24 - 236
Target Start/End: Complemental strand, 49708906 - 49708694
Alignment:
| Q |
24 |
ggaatcattcaagatgtcaaaggaagagttaaatgctataaacaagattgggtctgcgcaatctgttccggcgttaggtaatttattcttgttcattttc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49708906 |
ggaatcattcaagatgtcaaaggaagagttaaatgctataaacaagattgggtctgcgcaatctgttccggcgttaggtaatttattcttgttcattttc |
49708807 |
T |
 |
| Q |
124 |
atattgtatctaggactataatttttgttgtttgttgtgttcatttgcaacatctctgatttatgattgattaataataatgacagcatattggctccaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49708806 |
atattgtatctaggactataatttttgttgtttgttgtgttcatttgcaacatctctgatttatgattgattaataataatgacagcatattggctccaa |
49708707 |
T |
 |
| Q |
224 |
ctttctacatatt |
236 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49708706 |
ctttctacatatt |
49708694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University