View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1758_low_42 (Length: 264)
Name: NF1758_low_42
Description: NF1758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1758_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 34 - 246
Target Start/End: Original strand, 40440261 - 40440473
Alignment:
| Q |
34 |
ggtgtgtctggttatacaaatgtgagcaattcttccccttgaacgagatccctcaagaacctagggtttgcctagcatcgattcactttgatggtcttgc |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40440261 |
ggtgtgtctggttatacaaatgtgagcaattcttccccttggacgagatccctcaataacctagggttcgcctagcatcgattcactttgatggtcttgc |
40440360 |
T |
 |
| Q |
134 |
ccttcaatgacacttaaactacatgctggcaagatacaaatactcctccatggcaaaagtacgctgatgaagaccccctggctactttgattcacgtc-- |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40440361 |
ccttcaatgacacttaaactacatgcgggcaagatac-gatactcctccatggcaagagtatgctgatgaaga-cccctggctactttgattcacgtcaa |
40440458 |
T |
 |
| Q |
232 |
caacaaggtgggaag |
246 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40440459 |
caacaaggtgggaag |
40440473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University