View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1758_low_43 (Length: 264)

Name: NF1758_low_43
Description: NF1758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1758_low_43
NF1758_low_43
[»] chr7 (1 HSPs)
chr7 (42-264)||(47269423-47269645)


Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 42 - 264
Target Start/End: Complemental strand, 47269645 - 47269423
Alignment:
42 gtcgatctcatcgatctttgtcgatgccaaaccaagagggaaaacgcaacccaaatctgggtgaatcagatgcaaaagaacacaatatggtggcactgta 141  Q
    |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47269645 gtcgatctcatcgatctttgtcgacgccataccaagagggaaaacgcaacccaaatctgggtgaatcagatgcaaaagaacacaatatggtggcactgta 47269546  T
142 gagatcggtgttcacactccatgcgaaagaaatcaaatggagtatgccaaaataaaatagannnnnnnngtattagaactatttgcatgtgtttgattga 241  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||    
47269545 gagatcggtgttcacactccatgcgaaagaaatcaaatggagtatgccaaaataaaatagattttttttgtattagaactatttgcatgtgtttgattga 47269446  T
242 taacgagattcatcttattcaat 264  Q
    |||||||||||| ||||||||||    
47269445 taacgagattcaccttattcaat 47269423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University