View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1758_low_51 (Length: 236)
Name: NF1758_low_51
Description: NF1758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1758_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 44530649 - 44530868
Alignment:
| Q |
1 |
tttttaattttgaggtgggtgtggtcgttgatcgaaaacattgtatcttactata----tcaccaaatttcaactactgtatacaatgcaacatgatcaa |
96 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44530649 |
ttttcaattttgaggtgggtgtggtcgttgatcgaaaacattgtatcttactatatatatcaccaaatttcaactactgtatacaatgcaacatgatcaa |
44530748 |
T |
 |
| Q |
97 |
tcaagattacttggatttgtggaaagaaaactttcatattattaacgaactaagagattcattcataacaacaatattagtacaaaggtaacttagaaac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44530749 |
tcaagattacttggatttgtggaaagaaaactttcatattattaacgaactaagag----attcataacaacaatattagtacaaaggtaacttagaaac |
44530844 |
T |
 |
| Q |
197 |
aaagaaacaaagatattttgatga |
220 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
44530845 |
aaagaaacaaagatattttgatga |
44530868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University