View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17590_high_3 (Length: 376)
Name: NF17590_high_3
Description: NF17590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17590_high_3 |
 |  |
|
| [»] scaffold0090 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0090 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: scaffold0090
Description:
Target: scaffold0090; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 16 - 353
Target Start/End: Complemental strand, 10879 - 10541
Alignment:
| Q |
16 |
aaaatggatagtattttcaactttaactaaataaataaacaactatgtaatgactttctgtgttttctcagatgcaaagaaattgaaaattgcaacctt- |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10879 |
aaaatggatagtattttcaactttaactaaataaataaacaactatgtaatgactttctgtgttttctcagatgcaaagaaattgaaaattgcaaccttt |
10780 |
T |
 |
| Q |
115 |
gtagaccagaatgctctattttgtaaatgctctatatataatttcttgtattaattatatccccttatcaacacaaaatggcaattcttcctaccattct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
10779 |
gtagaccagaatgctctattttgtaaatgctctatatataatttcttgtattaattatattccctaatcaacacaaaatggcaattcttcctaccatcct |
10680 |
T |
 |
| Q |
215 |
tgtttttaccaagctactattattcttctccgaaatttcatttgcagccgatacaattacacaatcacttcctgatggaagcaccttggtttctaagggt |
314 |
Q |
| |
|
|||| |||| ||| | ||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10679 |
tgttattactaagttgctattattcttctccaaattttcatttgcaaccgatacaattacacaatcacttcctgatggaagcaccttggtttctaagggt |
10580 |
T |
 |
| Q |
315 |
ggagtatttgagttgggtttcttcaatccgggtagttcc |
353 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
10579 |
ggagtatttgagttaggtttcttcaatccaggtagttcc |
10541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University