View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17590_high_9 (Length: 316)
Name: NF17590_high_9
Description: NF17590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17590_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 34097488 - 34097670
Alignment:
| Q |
1 |
agtgaaatgtggtttcaaattttttccaatgctaagttgctcctgcatattgtcatcatcccatcctccttgatgtttatcccattgtgaggccttgcag |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
34097488 |
agtgaaatgtggtttcaaatttttcccaatgctaagttgctcctgcatattgtcatcatcccatcctccttgatatttatcccattgtgagaccttgcag |
34097587 |
T |
 |
| Q |
101 |
aactcgatgtacattcaaattcaaaaacacatggtgtgtggagcctggcttgaatgatgtggttcatgccaagttgcaaagta |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34097588 |
aactcgatgtacattcaaattcaaaaacacatggtgtgtggagcctggcttgaatgatgtggttcatgccaagttgcaaagta |
34097670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 225 - 300
Target Start/End: Original strand, 34097670 - 34097745
Alignment:
| Q |
225 |
aaaaatttggtacagtggaacaagaatcattgcaacaatctgaaaaaagaaatcgaggagtgtcgtaagaagttaa |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34097670 |
aaaaatttggtacaatggaacaagaatcattgcaacaatctgaaaaaagaaatcgaggagtgtcgtaagaagttaa |
34097745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University