View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17590_low_13 (Length: 235)
Name: NF17590_low_13
Description: NF17590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17590_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 95 - 221
Target Start/End: Complemental strand, 35203631 - 35203505
Alignment:
| Q |
95 |
ctcacaaatctaatcaatttcatcatctcatccagtttttaaaacatttgataaaatatcaccaccaatattcatgcattagtaaagtacgtacatagat |
194 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
35203631 |
ctcacaaatctcataaatttcatcatctcatccagtttttaaaacatttgataaaatatcaccacccatattcatgcattagtaaagtacatacatagat |
35203532 |
T |
 |
| Q |
195 |
agagataagctttatggacaaccatac |
221 |
Q |
| |
|
|||||||||||||||||||| |||||| |
|
|
| T |
35203531 |
agagataagctttatggacacccatac |
35203505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 17 - 61
Target Start/End: Complemental strand, 35203709 - 35203665
Alignment:
| Q |
17 |
acatctttaatatactttaataccaattgaactacaactcacatt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35203709 |
acatctttaatatactttaataccaattgaactacaactcacatt |
35203665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University