View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17591_high_6 (Length: 320)
Name: NF17591_high_6
Description: NF17591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17591_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 143 - 307
Target Start/End: Complemental strand, 24651429 - 24651262
Alignment:
| Q |
143 |
ttgaaaggacacaatattacatgatcatataacaatttgatcacagtttatttttt--aaatattttaacatttgcttaatttagaaaataaattcttcc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24651429 |
ttgaaaggacacaatattacatgatcatataacaatttgatcacagtttattttttttaaatattttaacatttgcttaatttagaaaataaattcttcc |
24651330 |
T |
 |
| Q |
241 |
ctcccccttctcg-aaacccccctcccaaaaagacagatgtgcttagactcagacccaccatagaact |
307 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24651329 |
ctcccccttctcgaaaacccccctcccaaaaagacagatgtgcttagactcagacccaccatagaact |
24651262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 24651583 - 24651474
Alignment:
| Q |
1 |
tcaatgttcatccttgtgttttgtagtcatagatagacaagtacgttttgtattatgattaatagaaacaaatcattctacatcaaaaacatgtatattc |
100 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24651583 |
tcaatattcatctttgtgttttgtagtcatagataaacaagtacgttttgtattatgattaatagaaacaaatcattctaaatcaaaaacatgtatattc |
24651484 |
T |
 |
| Q |
101 |
cctttgcccc |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
24651483 |
cctttgcccc |
24651474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University