View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17591_high_7 (Length: 287)
Name: NF17591_high_7
Description: NF17591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17591_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 35 - 272
Target Start/End: Complemental strand, 17066880 - 17066640
Alignment:
| Q |
35 |
aaaccattgaaaccacccgtgaccaaca---tctttattcctcatccccacactagtcgcaacccagtaaccccaccataccagaaagcctcaaactttc |
131 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17066880 |
aaaccattgaaaccacccgtgaccaacaacatctttatttctcatccccacactagtcgcaacccagtaaccccaccataccagaaagcctcaaacttac |
17066781 |
T |
|
| Q |
132 |
tatagtttcggtctacttataaattaaaaatatttgtgggattatgtaaggttcaatcataatttctaatatcgtcattgatatgcattgactacgatcg |
231 |
Q |
| |
|
| |||||||||||||| |||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17066780 |
tgtagtttcggtctacctataaattaaaaatatttatgggattatgttaggttcgatcataatttctaatatcgtcattgatatgcattgactacgattg |
17066681 |
T |
|
| Q |
232 |
ataacgtaatgaatattgtcaatcataatattaataataat |
272 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
17066680 |
ataacgtaatgaatattgtcaattatactattaataataat |
17066640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University