View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17591_low_11 (Length: 279)
Name: NF17591_low_11
Description: NF17591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17591_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 7837410 - 7837257
Alignment:
| Q |
1 |
tttcgatggaaattacggtgacaagcacaagcagcacatttgaagtattgtggggtaccttcttcaccgcttggcatgaattcaccacatccatctacca |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837410 |
tttcgatggaaattacggtgacaatcacaagcagcacatttgaagtattgtggggtaccttcttcaccgcttggcatgaattcaccacatccatctacca |
7837311 |
T |
 |
| Q |
101 |
cgtggcttcccatgcttgccgcgtggtttctcagacattctcggtaacatattt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837310 |
cgtggcttcccatgcttgccgcgtggtttctcagacattctcggtaacatattt |
7837257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 7837187 - 7837132
Alignment:
| Q |
224 |
cagccgttagatctggatctatgataggtctttgagaagaaggtgcaagatgtggt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7837187 |
cagccgttagatctggatctatgataggtctttgagaagaaggtgcaagatgtggt |
7837132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University